Review





Similar Products

90
Millipore plko.1puro lentiviral vectors with predesigned shrnas sh-sam68-2
Plko.1puro Lentiviral Vectors With Predesigned Shrnas Sh Sam68 2, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+sam68/anti+sam68/pmc10667349__BLOOD_BLD___2023___020400___mmc1-127-5-30
Average 90 stars, based on 1 article reviews
plko.1puro lentiviral vectors with predesigned shrnas sh-sam68-2 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Millipore sam68-shrna (shclnv-nm_006559)
<t>Sam68</t> is upregulated in the liver of fasting mice, HFD-induced obese and diabetic mice, and db/db diabetic mice. ( A , B ) Sam68 mRNA (qRT-PCR) ( A ) and protein (( B ), left panel, representative Western blot; right panel, quantification) expression were evaluated in the liver of WT mice under feeding condition or after fasting for 16 h. n = 3. ( C , D ) Sam68 protein expression was evaluated in the livers of ( C ) WT mice on normal diet (ND) or HFD for 12 weeks and of ( D ) db/m (control) and db/db mice at age of 8–12 weeks (left panel, representative Western blot; right panel, quantification). n = 4–5. Data are expressed as mean ± s.e.m. * p < 0.05, *** p < 0.001 (unpaired t test).
Sam68 Shrna (Shclnv Nm 006559), supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+sam68/anti+sam68/pmc09569775-82-0-10
Average 90 stars, based on 1 article reviews
sam68-shrna (shclnv-nm_006559) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Millipore mission® shrna sam68, trcn0000000048, id: nm_006559.x-527s1c1 plasmid
<t>Sam68</t> is upregulated in the liver of fasting mice, HFD-induced obese and diabetic mice, and db/db diabetic mice. ( A , B ) Sam68 mRNA (qRT-PCR) ( A ) and protein (( B ), left panel, representative Western blot; right panel, quantification) expression were evaluated in the liver of WT mice under feeding condition or after fasting for 16 h. n = 3. ( C , D ) Sam68 protein expression was evaluated in the livers of ( C ) WT mice on normal diet (ND) or HFD for 12 weeks and of ( D ) db/m (control) and db/db mice at age of 8–12 weeks (left panel, representative Western blot; right panel, quantification). n = 4–5. Data are expressed as mean ± s.e.m. * p < 0.05, *** p < 0.001 (unpaired t test).
Mission® Shrna Sam68, Trcn0000000048, Id: Nm 006559.X 527s1c1 Plasmid, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+sam68/anti+sam68/pm36010841-51-13-18
Average 90 stars, based on 1 article reviews
mission® shrna sam68, trcn0000000048, id: nm_006559.x-527s1c1 plasmid - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Millipore mission ® shrna sam68
<t>Sam68</t> is required for DDR activation in PC cells. ( A , B ) Representative immunofluorescence images of HEK293T cells infected with control (sh-Scr) lentivirus ( A ) or expressing RNA small interference for Sam68 (sh-Sam68) ( B ) treated, or not (vehicle), with NCS (30′, 500 ng/mL). Olaparib (10 µM, Selleck) was added 1 h before NCS treatment. After treatments, cells were fixed and stained with pS1981ATM antibody. ( C , D ) Bar graphs show the quantification of cells with more than five nuclear foci ( C ) and the fluorescence intensity relative to control ( D ). Bars, 10 μm, (n = 3; mean ± s.d.; ** p < 0.01, *** p < 0.001, t test).
Mission ® Shrna Sam68, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+sam68/anti+sam68/pmc09405969-48-10-19
Average 90 stars, based on 1 article reviews
mission ® shrna sam68 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Millipore khdrbs1 (sam68) targeting shrna expression plasmids
Reverse/β-turn peptidomimetic compounds are direct interactors of <t>Sam68</t> (A) Chemical structure of HAT inhibitor C646 and bromodomain ligand I-CBP112, as well as β-turn peptidomimetics ICG-001 and CWP232228. (B) Western blot analysis of CBP-catalyzed H3K14ac and H3K18ac histone acetylation marks in C646 (0.25 μM), I-CBP112 (0.25 μM), and CWP232228 (0.1 μM) t-hESCs versus control DMSO. Total histone H3 and GAPDH were used as loading control. Relative OD signal quantification versus H3 intensity is presented (C646: n = 3, I-CBP112: n = 5, CWP232228: n ≥ 3, ∗: p = 0.0183, ∗∗: p = 0.0078, ∗∗∗: p ≤ 0.00033, two-tailed t test). Data are represented as mean ± SEM (error bars). (C) Dose-response experiment assessing the impact of bromodomain ligand-based (C646 and I-CBP112), and peptidomimetic (CWP232228) inhibition of CBP on t-hESC growth (C646, I-CPB112: n = 4; CWP232228: n = 3). (D) Early endoderm differentiation assay performed in t-hESCs in the presence of CWP232228 (0.1 μM, n = 6), I-CBP112 (0.25 μM, n = 3), or C646 (0.25 μM, n = 3) versus control DMSO (n = 6) and basal culture media (n = 3). Bar graph represents relative counts of FOXA2-positive (early endoderm marker)/OCT4-negative cells in DMSO, CWP232228, I-CBP112, and C646-treated t-hESCs versus basal culture media (one-way ANOVA, ∗∗∗: p < 0.0001). Data are represented as mean ± SEM (error bars). Scale bar: 100 μm. (E) Pro-drug CWP232228 is converted into its active form CWP231904 via hydrolysis of the phosphate group by serum/cellular alkaline phosphatase. (F) Affinity pull-down experiments using CWP231904-conjugated magnetic beads performed on whole hESC lysates. Physical interaction between CBP, Sam68, beta-Catenin, ETS, MYB, GATA2, and PTMA with immobilized CWP231904 was assessed by immunoblotting. Each protein was previously shown as a member of the CBP interactome showing selective enrichment in human primary AML versus healthy blood ( <xref ref-type=Benoit et al., 2017 ). Excess of soluble compounds (CWP and ICG001, 100 μM) were used to compete with immobilized CWP231904. Whole-cell lysate was used as input, and amine-functionalized beads were used as negative control (n = 2). The heatmap presents mean background-corrected OD signal for each putative interactor tested (gray: not tested). " width="250" height="auto" />
Khdrbs1 (Sam68) Targeting Shrna Expression Plasmids, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+sam68/plko+1+vector/pmc08633986-448-2-14
Average 90 stars, based on 1 article reviews
khdrbs1 (sam68) targeting shrna expression plasmids - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Genechem sam68-shrna
Reverse/β-turn peptidomimetic compounds are direct interactors of <t>Sam68</t> (A) Chemical structure of HAT inhibitor C646 and bromodomain ligand I-CBP112, as well as β-turn peptidomimetics ICG-001 and CWP232228. (B) Western blot analysis of CBP-catalyzed H3K14ac and H3K18ac histone acetylation marks in C646 (0.25 μM), I-CBP112 (0.25 μM), and CWP232228 (0.1 μM) t-hESCs versus control DMSO. Total histone H3 and GAPDH were used as loading control. Relative OD signal quantification versus H3 intensity is presented (C646: n = 3, I-CBP112: n = 5, CWP232228: n ≥ 3, ∗: p = 0.0183, ∗∗: p = 0.0078, ∗∗∗: p ≤ 0.00033, two-tailed t test). Data are represented as mean ± SEM (error bars). (C) Dose-response experiment assessing the impact of bromodomain ligand-based (C646 and I-CBP112), and peptidomimetic (CWP232228) inhibition of CBP on t-hESC growth (C646, I-CPB112: n = 4; CWP232228: n = 3). (D) Early endoderm differentiation assay performed in t-hESCs in the presence of CWP232228 (0.1 μM, n = 6), I-CBP112 (0.25 μM, n = 3), or C646 (0.25 μM, n = 3) versus control DMSO (n = 6) and basal culture media (n = 3). Bar graph represents relative counts of FOXA2-positive (early endoderm marker)/OCT4-negative cells in DMSO, CWP232228, I-CBP112, and C646-treated t-hESCs versus basal culture media (one-way ANOVA, ∗∗∗: p < 0.0001). Data are represented as mean ± SEM (error bars). Scale bar: 100 μm. (E) Pro-drug CWP232228 is converted into its active form CWP231904 via hydrolysis of the phosphate group by serum/cellular alkaline phosphatase. (F) Affinity pull-down experiments using CWP231904-conjugated magnetic beads performed on whole hESC lysates. Physical interaction between CBP, Sam68, beta-Catenin, ETS, MYB, GATA2, and PTMA with immobilized CWP231904 was assessed by immunoblotting. Each protein was previously shown as a member of the CBP interactome showing selective enrichment in human primary AML versus healthy blood ( <xref ref-type=Benoit et al., 2017 ). Excess of soluble compounds (CWP and ICG001, 100 μM) were used to compete with immobilized CWP231904. Whole-cell lysate was used as input, and amine-functionalized beads were used as negative control (n = 2). The heatmap presents mean background-corrected OD signal for each putative interactor tested (gray: not tested). " width="250" height="auto" />
Sam68 Shrna, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+sam68/transfection+small+interfering+rna+sam68/pm26050229-77-1-7
Average 90 stars, based on 1 article reviews
sam68-shrna - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Thermo Fisher sam68 shrna#2 (gcatccagaggatacctttgc)
Reverse/β-turn peptidomimetic compounds are direct interactors of <t>Sam68</t> (A) Chemical structure of HAT inhibitor C646 and bromodomain ligand I-CBP112, as well as β-turn peptidomimetics ICG-001 and CWP232228. (B) Western blot analysis of CBP-catalyzed H3K14ac and H3K18ac histone acetylation marks in C646 (0.25 μM), I-CBP112 (0.25 μM), and CWP232228 (0.1 μM) t-hESCs versus control DMSO. Total histone H3 and GAPDH were used as loading control. Relative OD signal quantification versus H3 intensity is presented (C646: n = 3, I-CBP112: n = 5, CWP232228: n ≥ 3, ∗: p = 0.0183, ∗∗: p = 0.0078, ∗∗∗: p ≤ 0.00033, two-tailed t test). Data are represented as mean ± SEM (error bars). (C) Dose-response experiment assessing the impact of bromodomain ligand-based (C646 and I-CBP112), and peptidomimetic (CWP232228) inhibition of CBP on t-hESC growth (C646, I-CPB112: n = 4; CWP232228: n = 3). (D) Early endoderm differentiation assay performed in t-hESCs in the presence of CWP232228 (0.1 μM, n = 6), I-CBP112 (0.25 μM, n = 3), or C646 (0.25 μM, n = 3) versus control DMSO (n = 6) and basal culture media (n = 3). Bar graph represents relative counts of FOXA2-positive (early endoderm marker)/OCT4-negative cells in DMSO, CWP232228, I-CBP112, and C646-treated t-hESCs versus basal culture media (one-way ANOVA, ∗∗∗: p < 0.0001). Data are represented as mean ± SEM (error bars). Scale bar: 100 μm. (E) Pro-drug CWP232228 is converted into its active form CWP231904 via hydrolysis of the phosphate group by serum/cellular alkaline phosphatase. (F) Affinity pull-down experiments using CWP231904-conjugated magnetic beads performed on whole hESC lysates. Physical interaction between CBP, Sam68, beta-Catenin, ETS, MYB, GATA2, and PTMA with immobilized CWP231904 was assessed by immunoblotting. Each protein was previously shown as a member of the CBP interactome showing selective enrichment in human primary AML versus healthy blood ( <xref ref-type=Benoit et al., 2017 ). Excess of soluble compounds (CWP and ICG001, 100 μM) were used to compete with immobilized CWP231904. Whole-cell lysate was used as input, and amine-functionalized beads were used as negative control (n = 2). The heatmap presents mean background-corrected OD signal for each putative interactor tested (gray: not tested). " width="250" height="auto" />
Sam68 Shrna#2 (Gcatccagaggatacctttgc), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+sam68/pmc04577883-195-11-14
Average 90 stars, based on 1 article reviews
sam68 shrna#2 (gcatccagaggatacctttgc) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Thermo Fisher sam68 shrna#1 (ggaccacaagggaatacaatc)
Reverse/β-turn peptidomimetic compounds are direct interactors of <t>Sam68</t> (A) Chemical structure of HAT inhibitor C646 and bromodomain ligand I-CBP112, as well as β-turn peptidomimetics ICG-001 and CWP232228. (B) Western blot analysis of CBP-catalyzed H3K14ac and H3K18ac histone acetylation marks in C646 (0.25 μM), I-CBP112 (0.25 μM), and CWP232228 (0.1 μM) t-hESCs versus control DMSO. Total histone H3 and GAPDH were used as loading control. Relative OD signal quantification versus H3 intensity is presented (C646: n = 3, I-CBP112: n = 5, CWP232228: n ≥ 3, ∗: p = 0.0183, ∗∗: p = 0.0078, ∗∗∗: p ≤ 0.00033, two-tailed t test). Data are represented as mean ± SEM (error bars). (C) Dose-response experiment assessing the impact of bromodomain ligand-based (C646 and I-CBP112), and peptidomimetic (CWP232228) inhibition of CBP on t-hESC growth (C646, I-CPB112: n = 4; CWP232228: n = 3). (D) Early endoderm differentiation assay performed in t-hESCs in the presence of CWP232228 (0.1 μM, n = 6), I-CBP112 (0.25 μM, n = 3), or C646 (0.25 μM, n = 3) versus control DMSO (n = 6) and basal culture media (n = 3). Bar graph represents relative counts of FOXA2-positive (early endoderm marker)/OCT4-negative cells in DMSO, CWP232228, I-CBP112, and C646-treated t-hESCs versus basal culture media (one-way ANOVA, ∗∗∗: p < 0.0001). Data are represented as mean ± SEM (error bars). Scale bar: 100 μm. (E) Pro-drug CWP232228 is converted into its active form CWP231904 via hydrolysis of the phosphate group by serum/cellular alkaline phosphatase. (F) Affinity pull-down experiments using CWP231904-conjugated magnetic beads performed on whole hESC lysates. Physical interaction between CBP, Sam68, beta-Catenin, ETS, MYB, GATA2, and PTMA with immobilized CWP231904 was assessed by immunoblotting. Each protein was previously shown as a member of the CBP interactome showing selective enrichment in human primary AML versus healthy blood ( <xref ref-type=Benoit et al., 2017 ). Excess of soluble compounds (CWP and ICG001, 100 μM) were used to compete with immobilized CWP231904. Whole-cell lysate was used as input, and amine-functionalized beads were used as negative control (n = 2). The heatmap presents mean background-corrected OD signal for each putative interactor tested (gray: not tested). " width="250" height="auto" />
Sam68 Shrna#1 (Ggaccacaagggaatacaatc), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+sam68/pmc04577883-195-7-14
Average 90 stars, based on 1 article reviews
sam68 shrna#1 (ggaccacaagggaatacaatc) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

86
Thermo Fisher sam68 shrna
Reverse/β-turn peptidomimetic compounds are direct interactors of <t>Sam68</t> (A) Chemical structure of HAT inhibitor C646 and bromodomain ligand I-CBP112, as well as β-turn peptidomimetics ICG-001 and CWP232228. (B) Western blot analysis of CBP-catalyzed H3K14ac and H3K18ac histone acetylation marks in C646 (0.25 μM), I-CBP112 (0.25 μM), and CWP232228 (0.1 μM) t-hESCs versus control DMSO. Total histone H3 and GAPDH were used as loading control. Relative OD signal quantification versus H3 intensity is presented (C646: n = 3, I-CBP112: n = 5, CWP232228: n ≥ 3, ∗: p = 0.0183, ∗∗: p = 0.0078, ∗∗∗: p ≤ 0.00033, two-tailed t test). Data are represented as mean ± SEM (error bars). (C) Dose-response experiment assessing the impact of bromodomain ligand-based (C646 and I-CBP112), and peptidomimetic (CWP232228) inhibition of CBP on t-hESC growth (C646, I-CPB112: n = 4; CWP232228: n = 3). (D) Early endoderm differentiation assay performed in t-hESCs in the presence of CWP232228 (0.1 μM, n = 6), I-CBP112 (0.25 μM, n = 3), or C646 (0.25 μM, n = 3) versus control DMSO (n = 6) and basal culture media (n = 3). Bar graph represents relative counts of FOXA2-positive (early endoderm marker)/OCT4-negative cells in DMSO, CWP232228, I-CBP112, and C646-treated t-hESCs versus basal culture media (one-way ANOVA, ∗∗∗: p < 0.0001). Data are represented as mean ± SEM (error bars). Scale bar: 100 μm. (E) Pro-drug CWP232228 is converted into its active form CWP231904 via hydrolysis of the phosphate group by serum/cellular alkaline phosphatase. (F) Affinity pull-down experiments using CWP231904-conjugated magnetic beads performed on whole hESC lysates. Physical interaction between CBP, Sam68, beta-Catenin, ETS, MYB, GATA2, and PTMA with immobilized CWP231904 was assessed by immunoblotting. Each protein was previously shown as a member of the CBP interactome showing selective enrichment in human primary AML versus healthy blood ( <xref ref-type=Benoit et al., 2017 ). Excess of soluble compounds (CWP and ICG001, 100 μM) were used to compete with immobilized CWP231904. Whole-cell lysate was used as input, and amine-functionalized beads were used as negative control (n = 2). The heatmap presents mean background-corrected OD signal for each putative interactor tested (gray: not tested). " width="250" height="auto" />
Sam68 Shrna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+sam68/pm24316008-58-5-14
Average 86 stars, based on 1 article reviews
sam68 shrna - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

Image Search Results


Sam68 is upregulated in the liver of fasting mice, HFD-induced obese and diabetic mice, and db/db diabetic mice. ( A , B ) Sam68 mRNA (qRT-PCR) ( A ) and protein (( B ), left panel, representative Western blot; right panel, quantification) expression were evaluated in the liver of WT mice under feeding condition or after fasting for 16 h. n = 3. ( C , D ) Sam68 protein expression was evaluated in the livers of ( C ) WT mice on normal diet (ND) or HFD for 12 weeks and of ( D ) db/m (control) and db/db mice at age of 8–12 weeks (left panel, representative Western blot; right panel, quantification). n = 4–5. Data are expressed as mean ± s.e.m. * p < 0.05, *** p < 0.001 (unpaired t test).

Journal: International Journal of Molecular Sciences

Article Title: Hepatic Sam68 Regulates Systemic Glucose Homeostasis and Insulin Sensitivity

doi: 10.3390/ijms231911469

Figure Lengend Snippet: Sam68 is upregulated in the liver of fasting mice, HFD-induced obese and diabetic mice, and db/db diabetic mice. ( A , B ) Sam68 mRNA (qRT-PCR) ( A ) and protein (( B ), left panel, representative Western blot; right panel, quantification) expression were evaluated in the liver of WT mice under feeding condition or after fasting for 16 h. n = 3. ( C , D ) Sam68 protein expression was evaluated in the livers of ( C ) WT mice on normal diet (ND) or HFD for 12 weeks and of ( D ) db/m (control) and db/db mice at age of 8–12 weeks (left panel, representative Western blot; right panel, quantification). n = 4–5. Data are expressed as mean ± s.e.m. * p < 0.05, *** p < 0.001 (unpaired t test).

Article Snippet: Lentiviral plasmids Sam68-shRNA (SHCLNV-NM_006559) and non-targeting-shRNA (SHC016) were purchased from Sigma (Saint Louis, MO, USA).

Techniques: Quantitative RT-PCR, Western Blot, Expressing

Deletion of hepatic Sam68 attenuates glucagon-induced gluconeogenic gene expression. ( A ) Sam68 protein expression in the liver of Sam68 LKO and Sam68 f/f mice (left panel, representative Western blot; right panel, quantification). n = 5–6. ( B ) Blood glucose levels in the mice under feeding condition or after 16-h fasting. n = 8–9. ( C ) mRNA expression (qRT-PCR) of PGC-1α, PEPCK, and G6Pase in the liver of mice after 16-h fasting. n = 4. ( D ) Protein expression of PGC-1α, PEPCK, and G6Pase in the liver of mice under feeding condition or after 16 h fasting (left panel, representative Western blot; right panel, quantification). n = 3. ( E – G ) HepG2 cells were infected with lentiviral vector coding for Sam68-shRNA (KD) or non-targeting shRNA (NT), then the transduced cells were selected in puromycin for 14 days. ( E ) Sam68 protein expression was evaluated (left panel, representative Western blot; right panel, quantification). n = 3. ( F ) Glucose production was measured in the culture media of cells that had been treated with glucagon (100 nM) or PBS for 4 h. n = 3. ( G ) mRNA expression of gluconeogenic genes was measured in cells after treatment with glucagon (100 nM) for 0–3 h ( n = 3). Data are expressed as mean ± s.e.m. * p < 0.05, ** p < 0.01, *** p < 0.001, ns, not significant (( B , C , F ), and right panels of ( A , E ): unpaired t test; G and right panel of ( D ): two-way ANOVA).

Journal: International Journal of Molecular Sciences

Article Title: Hepatic Sam68 Regulates Systemic Glucose Homeostasis and Insulin Sensitivity

doi: 10.3390/ijms231911469

Figure Lengend Snippet: Deletion of hepatic Sam68 attenuates glucagon-induced gluconeogenic gene expression. ( A ) Sam68 protein expression in the liver of Sam68 LKO and Sam68 f/f mice (left panel, representative Western blot; right panel, quantification). n = 5–6. ( B ) Blood glucose levels in the mice under feeding condition or after 16-h fasting. n = 8–9. ( C ) mRNA expression (qRT-PCR) of PGC-1α, PEPCK, and G6Pase in the liver of mice after 16-h fasting. n = 4. ( D ) Protein expression of PGC-1α, PEPCK, and G6Pase in the liver of mice under feeding condition or after 16 h fasting (left panel, representative Western blot; right panel, quantification). n = 3. ( E – G ) HepG2 cells were infected with lentiviral vector coding for Sam68-shRNA (KD) or non-targeting shRNA (NT), then the transduced cells were selected in puromycin for 14 days. ( E ) Sam68 protein expression was evaluated (left panel, representative Western blot; right panel, quantification). n = 3. ( F ) Glucose production was measured in the culture media of cells that had been treated with glucagon (100 nM) or PBS for 4 h. n = 3. ( G ) mRNA expression of gluconeogenic genes was measured in cells after treatment with glucagon (100 nM) for 0–3 h ( n = 3). Data are expressed as mean ± s.e.m. * p < 0.05, ** p < 0.01, *** p < 0.001, ns, not significant (( B , C , F ), and right panels of ( A , E ): unpaired t test; G and right panel of ( D ): two-way ANOVA).

Article Snippet: Lentiviral plasmids Sam68-shRNA (SHCLNV-NM_006559) and non-targeting-shRNA (SHC016) were purchased from Sigma (Saint Louis, MO, USA).

Techniques: Expressing, Western Blot, Quantitative RT-PCR, Infection, Plasmid Preparation, shRNA

Sam68 interacts with CRTC2 in the nucleus, enhances CREB/CRTC2 transactivity, and co-occupies on the CRE motif in the promoters of gluconeogenic genes. ( A ) WT and Sam68 –/– primary hepatocytes were treated with glucagon (100 nM) for 30 min, then their nuclear and cytoplasmic fractions of proteins were isolated; Sam68 protein in each fraction was co-immunoprecipitated, and CRTC2 protein in the precipitates was detected by immunoblotting. ( B ) Plasmids coding for CRE-containing promoter-driven firefly luciferase expression and CMV promoter-driven renilla expression were co-transfected with different combinations of pcDNA3-HA (Empty), pcDNA3-HA-Sam68, pcDNA3-Flag-CRTC2, and/or pCF-Flag-CREB plasmids in HepG2 cells; 48 h later, luciferase activity was measured and normalized to renilla activity. n = 3. ( C ) WT and Sam68 –/– hepatocytes were treated with glucagon (100 nM), forskolin (10 μM), or Bt2-cAMP (100 μM) for 30 min; then, Sam68 occupancy on the CRE motif of promoters for PGC-1α, PEPCK, and G6Pase were evaluated via ChIP assay. n = 3. Data are expressed as mean ± s.e.m. ** p < 0.01, *** p < 0.001, ns, not significant (( B , C ): two-way ANOVA).

Journal: International Journal of Molecular Sciences

Article Title: Hepatic Sam68 Regulates Systemic Glucose Homeostasis and Insulin Sensitivity

doi: 10.3390/ijms231911469

Figure Lengend Snippet: Sam68 interacts with CRTC2 in the nucleus, enhances CREB/CRTC2 transactivity, and co-occupies on the CRE motif in the promoters of gluconeogenic genes. ( A ) WT and Sam68 –/– primary hepatocytes were treated with glucagon (100 nM) for 30 min, then their nuclear and cytoplasmic fractions of proteins were isolated; Sam68 protein in each fraction was co-immunoprecipitated, and CRTC2 protein in the precipitates was detected by immunoblotting. ( B ) Plasmids coding for CRE-containing promoter-driven firefly luciferase expression and CMV promoter-driven renilla expression were co-transfected with different combinations of pcDNA3-HA (Empty), pcDNA3-HA-Sam68, pcDNA3-Flag-CRTC2, and/or pCF-Flag-CREB plasmids in HepG2 cells; 48 h later, luciferase activity was measured and normalized to renilla activity. n = 3. ( C ) WT and Sam68 –/– hepatocytes were treated with glucagon (100 nM), forskolin (10 μM), or Bt2-cAMP (100 μM) for 30 min; then, Sam68 occupancy on the CRE motif of promoters for PGC-1α, PEPCK, and G6Pase were evaluated via ChIP assay. n = 3. Data are expressed as mean ± s.e.m. ** p < 0.01, *** p < 0.001, ns, not significant (( B , C ): two-way ANOVA).

Article Snippet: Lentiviral plasmids Sam68-shRNA (SHCLNV-NM_006559) and non-targeting-shRNA (SHC016) were purchased from Sigma (Saint Louis, MO, USA).

Techniques: Isolation, Immunoprecipitation, Western Blot, Luciferase, Expressing, Transfection, Activity Assay

Sam68 promotes gluconeogenesis through CRTC2. pcDNA3-HA-Sam68 or pcDNA3-HA (Empty) plasmid was co-transfected with CRTC2 siRNA or non-targeting siRNA in HepG2 cells; 48 h later, the efficiencies of transfections were evaluated by qRT-PCR for Sam68 ( A ) and CRTC2 ( B ) mRNA expression and by Western blotting for ( C ) Sam68 and CRTC2 protein levels. n = 3. The transduced cells were also treated with glucagon (100 nM), then ( D ) glucose produced in the cell-culture media was measured after 4 h of treatment ( n = 3), and ( E ) mRNA expression of PGC-1α, PEPCK, and G6Pase were evaluated at 0 [basal], 1, 2, and 3 h of treatment ( n = 3 per time point). Data are expressed as mean ± s.e.m. * p < 0.05, ** p < 0.01, *** p < 0.001, ns, not significant (two-way ANOVA).

Journal: International Journal of Molecular Sciences

Article Title: Hepatic Sam68 Regulates Systemic Glucose Homeostasis and Insulin Sensitivity

doi: 10.3390/ijms231911469

Figure Lengend Snippet: Sam68 promotes gluconeogenesis through CRTC2. pcDNA3-HA-Sam68 or pcDNA3-HA (Empty) plasmid was co-transfected with CRTC2 siRNA or non-targeting siRNA in HepG2 cells; 48 h later, the efficiencies of transfections were evaluated by qRT-PCR for Sam68 ( A ) and CRTC2 ( B ) mRNA expression and by Western blotting for ( C ) Sam68 and CRTC2 protein levels. n = 3. The transduced cells were also treated with glucagon (100 nM), then ( D ) glucose produced in the cell-culture media was measured after 4 h of treatment ( n = 3), and ( E ) mRNA expression of PGC-1α, PEPCK, and G6Pase were evaluated at 0 [basal], 1, 2, and 3 h of treatment ( n = 3 per time point). Data are expressed as mean ± s.e.m. * p < 0.05, ** p < 0.01, *** p < 0.001, ns, not significant (two-way ANOVA).

Article Snippet: Lentiviral plasmids Sam68-shRNA (SHCLNV-NM_006559) and non-targeting-shRNA (SHC016) were purchased from Sigma (Saint Louis, MO, USA).

Techniques: Plasmid Preparation, Transfection, Quantitative RT-PCR, Expressing, Western Blot, Produced, Cell Culture

Sam68 shuttling between the cytoplasm and nucleus is regulated by the opposing actions of insulin and glucagon. ( A , B ) WT primary hepatocytes were treated with ( A ) insulin (100 nM) or ( B ) glucagon (100 nM) for 30 min; PBS was used as control treatment. Then, whole cellular, nuclear, and cytoplasmic fractions of proteins were isolated, and the abundance of Sam68 protein in each fraction was analyzed by Western blotting. ( C , D ) WT mice were intraperitoneally injected with ( C ) insulin (1 U/kg body weight) or ( D ) glucagon (30 µg/kg body weight); PBS was used as control injection. Nuclear and cytoplasmic fractions were isolated from liver tissues 20 min after insulin injection or 10 min after glucagon injection, and Sam68 protein expression in each fraction was evaluated (left panel, representative Western blot; right panel, quantification). n = 3. * p < 0.05, *** p < 0.001, ns, not significant (right panel of ( C , D ): unpaired t test).

Journal: International Journal of Molecular Sciences

Article Title: Hepatic Sam68 Regulates Systemic Glucose Homeostasis and Insulin Sensitivity

doi: 10.3390/ijms231911469

Figure Lengend Snippet: Sam68 shuttling between the cytoplasm and nucleus is regulated by the opposing actions of insulin and glucagon. ( A , B ) WT primary hepatocytes were treated with ( A ) insulin (100 nM) or ( B ) glucagon (100 nM) for 30 min; PBS was used as control treatment. Then, whole cellular, nuclear, and cytoplasmic fractions of proteins were isolated, and the abundance of Sam68 protein in each fraction was analyzed by Western blotting. ( C , D ) WT mice were intraperitoneally injected with ( C ) insulin (1 U/kg body weight) or ( D ) glucagon (30 µg/kg body weight); PBS was used as control injection. Nuclear and cytoplasmic fractions were isolated from liver tissues 20 min after insulin injection or 10 min after glucagon injection, and Sam68 protein expression in each fraction was evaluated (left panel, representative Western blot; right panel, quantification). n = 3. * p < 0.05, *** p < 0.001, ns, not significant (right panel of ( C , D ): unpaired t test).

Article Snippet: Lentiviral plasmids Sam68-shRNA (SHCLNV-NM_006559) and non-targeting-shRNA (SHC016) were purchased from Sigma (Saint Louis, MO, USA).

Techniques: Isolation, Western Blot, Injection, Expressing

Deletion of hepatic Sam68 improves systemic insulin sensitivity in HFD-fed mice. Four-week-old Sam68 LKO and Sam68 f/f mice were fed with HFD for twelve weeks and analyzed. ( A , B ) Blood glucose levels were measured in mice ( A ) under feeding conditions or after 16 h fasting ( n = 9–10) and ( B ) in the ITT (insulin tolerance test; n = 7–8). ( C – E ) Sam68 LKO and Sam68 f/f mice were intraperitoneally injected with insulin (+) or PBS (–); 20 min later, ( C ) liver ( n = 3–5); ( D ) epiWAT ( n = 3–4), and ( E ) skeletal muscle tissues ( n = 3–4) were harvested, and the protein levels of phosphorylated AKT (at amino acids Ser-473 and Thr-308) and total AKT were evaluated (left panel, representative Western blot; right panel, quantification). Data are expressed as mean ± s.e.m. * p < 0.05, ** p < 0.01, *** p < 0.001, ns, not significant (( A ): unpaired t test; ( B – E ): two-way ANOVA).

Journal: International Journal of Molecular Sciences

Article Title: Hepatic Sam68 Regulates Systemic Glucose Homeostasis and Insulin Sensitivity

doi: 10.3390/ijms231911469

Figure Lengend Snippet: Deletion of hepatic Sam68 improves systemic insulin sensitivity in HFD-fed mice. Four-week-old Sam68 LKO and Sam68 f/f mice were fed with HFD for twelve weeks and analyzed. ( A , B ) Blood glucose levels were measured in mice ( A ) under feeding conditions or after 16 h fasting ( n = 9–10) and ( B ) in the ITT (insulin tolerance test; n = 7–8). ( C – E ) Sam68 LKO and Sam68 f/f mice were intraperitoneally injected with insulin (+) or PBS (–); 20 min later, ( C ) liver ( n = 3–5); ( D ) epiWAT ( n = 3–4), and ( E ) skeletal muscle tissues ( n = 3–4) were harvested, and the protein levels of phosphorylated AKT (at amino acids Ser-473 and Thr-308) and total AKT were evaluated (left panel, representative Western blot; right panel, quantification). Data are expressed as mean ± s.e.m. * p < 0.05, ** p < 0.01, *** p < 0.001, ns, not significant (( A ): unpaired t test; ( B – E ): two-way ANOVA).

Article Snippet: Lentiviral plasmids Sam68-shRNA (SHCLNV-NM_006559) and non-targeting-shRNA (SHC016) were purchased from Sigma (Saint Louis, MO, USA).

Techniques: Injection, Western Blot

Schematic presentation of molecular mechanisms underlying Sam68 subcellular shuttling and Sam68-mediated hepatic gluconeogenesis. Our results suggest that Sam68 shuttling between the nucleus and cytoplasm is regulated by the opposing actions of glucagon and insulin and plays an important role in the regulation of hepatic gluconeogenesis and glucose production. Specifically, glucagon signaling triggers Sam68 translocation into the nucleus, where Sam68 interacts with CRTC2 to augment CREB/CRTC2 transactivity and gluconeogenic gene expression, promoting glucose production. On the other hand, insulin signaling promotes Sam68 export to the cytoplasm, diminishing CREB/CRTC2 transactivity and gluconeogenesis. In diabetes, hepatic Sam68 expression is elevated, and the skewed metabolic signaling, i.e., increased glucagon signaling and/or decreased insulin signaling, induces Sam68 translocation into the nucleus, where it augments CREB/CRTC2 transactivity, leading to hyperglycemia. GCGR: glucagon receptor; AC: adenylyl cyclase; PKA: protein kinase A; SMEK/PP4C: suppressor of MEK null/protein phosphatase 4 catalytic subunits; PP2B: protein phosphatase 2B.

Journal: International Journal of Molecular Sciences

Article Title: Hepatic Sam68 Regulates Systemic Glucose Homeostasis and Insulin Sensitivity

doi: 10.3390/ijms231911469

Figure Lengend Snippet: Schematic presentation of molecular mechanisms underlying Sam68 subcellular shuttling and Sam68-mediated hepatic gluconeogenesis. Our results suggest that Sam68 shuttling between the nucleus and cytoplasm is regulated by the opposing actions of glucagon and insulin and plays an important role in the regulation of hepatic gluconeogenesis and glucose production. Specifically, glucagon signaling triggers Sam68 translocation into the nucleus, where Sam68 interacts with CRTC2 to augment CREB/CRTC2 transactivity and gluconeogenic gene expression, promoting glucose production. On the other hand, insulin signaling promotes Sam68 export to the cytoplasm, diminishing CREB/CRTC2 transactivity and gluconeogenesis. In diabetes, hepatic Sam68 expression is elevated, and the skewed metabolic signaling, i.e., increased glucagon signaling and/or decreased insulin signaling, induces Sam68 translocation into the nucleus, where it augments CREB/CRTC2 transactivity, leading to hyperglycemia. GCGR: glucagon receptor; AC: adenylyl cyclase; PKA: protein kinase A; SMEK/PP4C: suppressor of MEK null/protein phosphatase 4 catalytic subunits; PP2B: protein phosphatase 2B.

Article Snippet: Lentiviral plasmids Sam68-shRNA (SHCLNV-NM_006559) and non-targeting-shRNA (SHC016) were purchased from Sigma (Saint Louis, MO, USA).

Techniques: Translocation Assay, Expressing

Sam68 is required for DDR activation in PC cells. ( A , B ) Representative immunofluorescence images of HEK293T cells infected with control (sh-Scr) lentivirus ( A ) or expressing RNA small interference for Sam68 (sh-Sam68) ( B ) treated, or not (vehicle), with NCS (30′, 500 ng/mL). Olaparib (10 µM, Selleck) was added 1 h before NCS treatment. After treatments, cells were fixed and stained with pS1981ATM antibody. ( C , D ) Bar graphs show the quantification of cells with more than five nuclear foci ( C ) and the fluorescence intensity relative to control ( D ). Bars, 10 μm, (n = 3; mean ± s.d.; ** p < 0.01, *** p < 0.001, t test).

Journal: Cancers

Article Title: DNA Damage Regulates the Functions of the RNA Binding Protein Sam68 through ATM-Dependent Phosphorylation

doi: 10.3390/cancers14163847

Figure Lengend Snippet: Sam68 is required for DDR activation in PC cells. ( A , B ) Representative immunofluorescence images of HEK293T cells infected with control (sh-Scr) lentivirus ( A ) or expressing RNA small interference for Sam68 (sh-Sam68) ( B ) treated, or not (vehicle), with NCS (30′, 500 ng/mL). Olaparib (10 µM, Selleck) was added 1 h before NCS treatment. After treatments, cells were fixed and stained with pS1981ATM antibody. ( C , D ) Bar graphs show the quantification of cells with more than five nuclear foci ( C ) and the fluorescence intensity relative to control ( D ). Bars, 10 μm, (n = 3; mean ± s.d.; ** p < 0.01, *** p < 0.001, t test).

Article Snippet: RNA interference cells were infected with lentiviral particles produced using Mission ® shRNA SAM68, TRCN0000000048, Clone ID: NM_006559.x-527s1c1 plasmid (Sigma-Aldrich, St. Louis, MO, USA).

Techniques: Activation Assay, Immunofluorescence, Infection, Expressing, Staining, Fluorescence

Sam68 interacts with ATM kinase, and it is phosphorylated on SQ/TQ motif upon DDR induction. ( A ) HEK293T cells were transiently transfected with a combination of different constructs that allow the overexpression of the fusion proteins GFP-Sam68 (pCDNA GFP-Sam68) and ATM-Flag (pCDNA FLAG-ATM) as indicated. Representative western blot of total protein extracts (whole-cell lysate, WCL) (293T WCL) and protein extracts subjected to co-immunoprecipitation assay. Co-immunoprecipitations were performed using anti-GFP (IP: GFP) or anti-FLAG (IP: FLAG) antibodies and immunoblotted with the indicated antibodies. ( B ) LNCaP cells were treated, or not, with KU55933 10 μM for 2 h and/or neocarzinostatin (NCS) 500 ng/mL for 1 h. Representative western blot of total protein extracts and protein extracts (LNCaP WCL) subjected to co-immunoprecipitation assay using anti-ATM (IP: ATM) antibody and IgG (IgG) as negative control. ( C ) HEK293T cells were transiently transfected as in ( A ) and treated, or not, KU55933 10 μM for 2 h. Representative western blot of WCL (293T WCL) and protein extracts subjected to immunoprecipitation assay using anti-GFP (IP: GFP) and immunoblotted with the indicated antibodies. Bar graph shows the densitometric analysis of pSQ/TQ signals with respect to GFP (western blot assays) in IP experiments (n = 3; mean ± s.d., *** p < 0.001, Student’s t test). ( D ) PC LNCaP cells were treated, or not, with KU55933 10 μM for 2 h and/or neocarzinostatin (NCS) 500 ng/mL for 1 h. Representative western blot of total protein extracts and proteins co-immunoprecipitated with anti-Sam68 antibody (IP: Sam68).

Journal: Cancers

Article Title: DNA Damage Regulates the Functions of the RNA Binding Protein Sam68 through ATM-Dependent Phosphorylation

doi: 10.3390/cancers14163847

Figure Lengend Snippet: Sam68 interacts with ATM kinase, and it is phosphorylated on SQ/TQ motif upon DDR induction. ( A ) HEK293T cells were transiently transfected with a combination of different constructs that allow the overexpression of the fusion proteins GFP-Sam68 (pCDNA GFP-Sam68) and ATM-Flag (pCDNA FLAG-ATM) as indicated. Representative western blot of total protein extracts (whole-cell lysate, WCL) (293T WCL) and protein extracts subjected to co-immunoprecipitation assay. Co-immunoprecipitations were performed using anti-GFP (IP: GFP) or anti-FLAG (IP: FLAG) antibodies and immunoblotted with the indicated antibodies. ( B ) LNCaP cells were treated, or not, with KU55933 10 μM for 2 h and/or neocarzinostatin (NCS) 500 ng/mL for 1 h. Representative western blot of total protein extracts and protein extracts (LNCaP WCL) subjected to co-immunoprecipitation assay using anti-ATM (IP: ATM) antibody and IgG (IgG) as negative control. ( C ) HEK293T cells were transiently transfected as in ( A ) and treated, or not, KU55933 10 μM for 2 h. Representative western blot of WCL (293T WCL) and protein extracts subjected to immunoprecipitation assay using anti-GFP (IP: GFP) and immunoblotted with the indicated antibodies. Bar graph shows the densitometric analysis of pSQ/TQ signals with respect to GFP (western blot assays) in IP experiments (n = 3; mean ± s.d., *** p < 0.001, Student’s t test). ( D ) PC LNCaP cells were treated, or not, with KU55933 10 μM for 2 h and/or neocarzinostatin (NCS) 500 ng/mL for 1 h. Representative western blot of total protein extracts and proteins co-immunoprecipitated with anti-Sam68 antibody (IP: Sam68).

Article Snippet: RNA interference cells were infected with lentiviral particles produced using Mission ® shRNA SAM68, TRCN0000000048, Clone ID: NM_006559.x-527s1c1 plasmid (Sigma-Aldrich, St. Louis, MO, USA).

Techniques: Transfection, Construct, Over Expression, Western Blot, Co-Immunoprecipitation Assay, Negative Control, Immunoprecipitation

Preferential phosphorylation of T61 on Sam68 by ATM kinase activation upon DDR induction. ( A ) Schematic representation of putative serine and threonine residues on Sam68 phosphorylated by ATM kinase. ( B ) HEK293T cells were transiently transfected with fusion protein with either wild-type, GFP-Sam68 WT , or mutants lacking threonine 61 phosphorylation sites, GFP-Sam68 T61A , as indicated, and treated or not with NCS (500 ng/mL) for 1 h. Representative western blot of total protein extracts (whole-cell lysate, WCL) and protein extracts subjected to immunoprecipitation assay using anti-SQ/TQ antibody (IP: SQTQ) and immunoblotted with the indicated antibodies. Vinculin was evaluated as loading control of total protein extracts. ( C ) HEK293T were transiently transfected with either wild-type GFP-Sam68 WT or mutants lacking TQ/SQ phosphorylation sites, as shown in the schematic representation in ( A ), and treated, or not, with NCS (500 ng/mL) for 1 h. Representative western blot of total protein extracts (whole-cell lysate, WCL) and protein extracts subjected to immunoprecipitation assay using anti-GFP (IP: GFP) antibody and immunoblotted with the indicated antibodies. β-actin was evaluated as loading control of total protein extracts.

Journal: Cancers

Article Title: DNA Damage Regulates the Functions of the RNA Binding Protein Sam68 through ATM-Dependent Phosphorylation

doi: 10.3390/cancers14163847

Figure Lengend Snippet: Preferential phosphorylation of T61 on Sam68 by ATM kinase activation upon DDR induction. ( A ) Schematic representation of putative serine and threonine residues on Sam68 phosphorylated by ATM kinase. ( B ) HEK293T cells were transiently transfected with fusion protein with either wild-type, GFP-Sam68 WT , or mutants lacking threonine 61 phosphorylation sites, GFP-Sam68 T61A , as indicated, and treated or not with NCS (500 ng/mL) for 1 h. Representative western blot of total protein extracts (whole-cell lysate, WCL) and protein extracts subjected to immunoprecipitation assay using anti-SQ/TQ antibody (IP: SQTQ) and immunoblotted with the indicated antibodies. Vinculin was evaluated as loading control of total protein extracts. ( C ) HEK293T were transiently transfected with either wild-type GFP-Sam68 WT or mutants lacking TQ/SQ phosphorylation sites, as shown in the schematic representation in ( A ), and treated, or not, with NCS (500 ng/mL) for 1 h. Representative western blot of total protein extracts (whole-cell lysate, WCL) and protein extracts subjected to immunoprecipitation assay using anti-GFP (IP: GFP) antibody and immunoblotted with the indicated antibodies. β-actin was evaluated as loading control of total protein extracts.

Article Snippet: RNA interference cells were infected with lentiviral particles produced using Mission ® shRNA SAM68, TRCN0000000048, Clone ID: NM_006559.x-527s1c1 plasmid (Sigma-Aldrich, St. Louis, MO, USA).

Techniques: Activation Assay, Transfection, Western Blot, Immunoprecipitation

Sam68 phosphorylation on T61 is necessary for NF-κB activation and Sam68-PARP interaction upon DDR induction. ( A , B ) HEK293T cells were transiently transfected with fusion protein with either wild-type, GFP-Sam68 WT , or mutant lacking threonin 61 phosphorylation site, GFP-Sam68 T61A , and treated, or not, with NCS (500 ng/mL) and collected at the indicated time points (hours). ( A ) Representative western blot of protein extracts subjected to immunoprecipitation assay using anti-GFP antibody (IP: GFP) and immunoblotted with the indicated antibodies. ( B ) Representative western blot of total protein extracts (whole-cell lysate, WCL) and immunoblotted with the indicated antibodies. HSP90 was evaluated as loading control of total protein extracts. ( C ) Representative western blot of co-immunoprecipitation assay using anti-GFP (IP: GFP) antibody performed using WCL from HEK293T cells transfected with wild-type, GFP-Sam68 WT , and GFP-Sam68 T61A and GFP-Sam68 S388A/S390A mutants, and treated, or not, with NCS (500 ng/mL) for the indicated time points (hours). ( D ) Bar graph represents viability assay performed in HEK293T cells transiently transfected, or not (GFP), with the indicated GFP-Sam68 plasmids and treated with NCS (500 ng/mL) (mean ± s.d., n = 3). After 48 h, cell viability was assessed by the Cell Titer Glo Luminescent Assay and reported as the percentage of cell viability with respected to untreated cells (100% viability). Statistical significance (** p < 0.01, *** p < 0.001, **** p < 0.0001; Student’s t -test) was evaluated with respect to GFP expressing cells treated with NCS (light grey bar). Brackets indicate additional statistical analysis of the indicated samples.

Journal: Cancers

Article Title: DNA Damage Regulates the Functions of the RNA Binding Protein Sam68 through ATM-Dependent Phosphorylation

doi: 10.3390/cancers14163847

Figure Lengend Snippet: Sam68 phosphorylation on T61 is necessary for NF-κB activation and Sam68-PARP interaction upon DDR induction. ( A , B ) HEK293T cells were transiently transfected with fusion protein with either wild-type, GFP-Sam68 WT , or mutant lacking threonin 61 phosphorylation site, GFP-Sam68 T61A , and treated, or not, with NCS (500 ng/mL) and collected at the indicated time points (hours). ( A ) Representative western blot of protein extracts subjected to immunoprecipitation assay using anti-GFP antibody (IP: GFP) and immunoblotted with the indicated antibodies. ( B ) Representative western blot of total protein extracts (whole-cell lysate, WCL) and immunoblotted with the indicated antibodies. HSP90 was evaluated as loading control of total protein extracts. ( C ) Representative western blot of co-immunoprecipitation assay using anti-GFP (IP: GFP) antibody performed using WCL from HEK293T cells transfected with wild-type, GFP-Sam68 WT , and GFP-Sam68 T61A and GFP-Sam68 S388A/S390A mutants, and treated, or not, with NCS (500 ng/mL) for the indicated time points (hours). ( D ) Bar graph represents viability assay performed in HEK293T cells transiently transfected, or not (GFP), with the indicated GFP-Sam68 plasmids and treated with NCS (500 ng/mL) (mean ± s.d., n = 3). After 48 h, cell viability was assessed by the Cell Titer Glo Luminescent Assay and reported as the percentage of cell viability with respected to untreated cells (100% viability). Statistical significance (** p < 0.01, *** p < 0.001, **** p < 0.0001; Student’s t -test) was evaluated with respect to GFP expressing cells treated with NCS (light grey bar). Brackets indicate additional statistical analysis of the indicated samples.

Article Snippet: RNA interference cells were infected with lentiviral particles produced using Mission ® shRNA SAM68, TRCN0000000048, Clone ID: NM_006559.x-527s1c1 plasmid (Sigma-Aldrich, St. Louis, MO, USA).

Techniques: Activation Assay, Transfection, Mutagenesis, Western Blot, Immunoprecipitation, Co-Immunoprecipitation Assay, Viability Assay, Luminescence Assay, Expressing

ATMmodulates Sam68 RNA binding affinity upon DDR induction. ( A – C ) Western blot analysis of pull-down assays performed using synthetic homopolymeric RNA. HEK293T cells were transiently transfected with indicated GFP-Sam68 plasmids and/or in addition to FLAG-ATM ( A – C ). After 24 h, cells have been treated, or not, with neocarzinostatin (NCS, 500 ng/mL) for 1 h ( A ) in presence, or not, of KU55933 (1 h) ( B ). Cell extracts (WCL) were incubated with either polyA-Sepharose (polyA) and streptavidine–Sepharose (Seph.) beads. Streptavidine–Sepharose beads have been used as negative control.

Journal: Cancers

Article Title: DNA Damage Regulates the Functions of the RNA Binding Protein Sam68 through ATM-Dependent Phosphorylation

doi: 10.3390/cancers14163847

Figure Lengend Snippet: ATMmodulates Sam68 RNA binding affinity upon DDR induction. ( A – C ) Western blot analysis of pull-down assays performed using synthetic homopolymeric RNA. HEK293T cells were transiently transfected with indicated GFP-Sam68 plasmids and/or in addition to FLAG-ATM ( A – C ). After 24 h, cells have been treated, or not, with neocarzinostatin (NCS, 500 ng/mL) for 1 h ( A ) in presence, or not, of KU55933 (1 h) ( B ). Cell extracts (WCL) were incubated with either polyA-Sepharose (polyA) and streptavidine–Sepharose (Seph.) beads. Streptavidine–Sepharose beads have been used as negative control.

Article Snippet: RNA interference cells were infected with lentiviral particles produced using Mission ® shRNA SAM68, TRCN0000000048, Clone ID: NM_006559.x-527s1c1 plasmid (Sigma-Aldrich, St. Louis, MO, USA).

Techniques: RNA Binding Assay, Western Blot, Transfection, Incubation, Negative Control

ATM-dependent phosphorylation modulates Sam68 splicing activity. ( A ) Schematic representation of CD44 minigene construct: v5 is the exon included in presence of Sam68 and black arrows indicate primers used for the RT-PCR analysis. ( B , C ) Representative PCR agarose gel of splicing assays of CD44 minigene performed in HEK293T cells transiently transfected with the indicated GFP-Sam68 plasmids and/or in addition to FLAG-ATM plasmid in presence of CD44 minigene ( B , C ). The percent spliced in (PSI) is reported in B and C (* p < 0.05, ** p < 0.01, *** p < 0.001, t test). L34 hasbeen used as a loading control ( B ). Western blot analysis to evaluate GFP-Sam68 proteins expression is also shown. β-actin was used as loading control ( C ).

Journal: Cancers

Article Title: DNA Damage Regulates the Functions of the RNA Binding Protein Sam68 through ATM-Dependent Phosphorylation

doi: 10.3390/cancers14163847

Figure Lengend Snippet: ATM-dependent phosphorylation modulates Sam68 splicing activity. ( A ) Schematic representation of CD44 minigene construct: v5 is the exon included in presence of Sam68 and black arrows indicate primers used for the RT-PCR analysis. ( B , C ) Representative PCR agarose gel of splicing assays of CD44 minigene performed in HEK293T cells transiently transfected with the indicated GFP-Sam68 plasmids and/or in addition to FLAG-ATM plasmid in presence of CD44 minigene ( B , C ). The percent spliced in (PSI) is reported in B and C (* p < 0.05, ** p < 0.01, *** p < 0.001, t test). L34 hasbeen used as a loading control ( B ). Western blot analysis to evaluate GFP-Sam68 proteins expression is also shown. β-actin was used as loading control ( C ).

Article Snippet: RNA interference cells were infected with lentiviral particles produced using Mission ® shRNA SAM68, TRCN0000000048, Clone ID: NM_006559.x-527s1c1 plasmid (Sigma-Aldrich, St. Louis, MO, USA).

Techniques: Activity Assay, Construct, Reverse Transcription Polymerase Chain Reaction, Agarose Gel Electrophoresis, Transfection, Plasmid Preparation, Western Blot, Expressing

Sam68 APA activity is modulated upon DDR induction in an ATM-dependent way. ( A – D ) Bar graphs showing qPCR analyses of polyadenylation site (pA) usage evaluated in two representative genes ( SETMAR and PRKACB ) undergoing regulation in cells knocked down for Sam68 (si-Sam68) ( A , C ) or ATM (sh-ATM) and treated, or not, with neocarzinostatin (NCS, 500 ng/mL) for 1 and 6 h ( B , D ). Internal pA (IPA) usage was reported as 2 −ΔCt with respect to distal pA (d-pA) (* p < 0.05, ** p < 0.01, n.s. not significant, t test) ( A – D ). A schematic representation of SETMAR and PRKACB alternative polyadenylation events is also shown ( A , C ).

Journal: Cancers

Article Title: DNA Damage Regulates the Functions of the RNA Binding Protein Sam68 through ATM-Dependent Phosphorylation

doi: 10.3390/cancers14163847

Figure Lengend Snippet: Sam68 APA activity is modulated upon DDR induction in an ATM-dependent way. ( A – D ) Bar graphs showing qPCR analyses of polyadenylation site (pA) usage evaluated in two representative genes ( SETMAR and PRKACB ) undergoing regulation in cells knocked down for Sam68 (si-Sam68) ( A , C ) or ATM (sh-ATM) and treated, or not, with neocarzinostatin (NCS, 500 ng/mL) for 1 and 6 h ( B , D ). Internal pA (IPA) usage was reported as 2 −ΔCt with respect to distal pA (d-pA) (* p < 0.05, ** p < 0.01, n.s. not significant, t test) ( A – D ). A schematic representation of SETMAR and PRKACB alternative polyadenylation events is also shown ( A , C ).

Article Snippet: RNA interference cells were infected with lentiviral particles produced using Mission ® shRNA SAM68, TRCN0000000048, Clone ID: NM_006559.x-527s1c1 plasmid (Sigma-Aldrich, St. Louis, MO, USA).

Techniques: Activity Assay

Reverse/β-turn peptidomimetic compounds are direct interactors of Sam68 (A) Chemical structure of HAT inhibitor C646 and bromodomain ligand I-CBP112, as well as β-turn peptidomimetics ICG-001 and CWP232228. (B) Western blot analysis of CBP-catalyzed H3K14ac and H3K18ac histone acetylation marks in C646 (0.25 μM), I-CBP112 (0.25 μM), and CWP232228 (0.1 μM) t-hESCs versus control DMSO. Total histone H3 and GAPDH were used as loading control. Relative OD signal quantification versus H3 intensity is presented (C646: n = 3, I-CBP112: n = 5, CWP232228: n ≥ 3, ∗: p = 0.0183, ∗∗: p = 0.0078, ∗∗∗: p ≤ 0.00033, two-tailed t test). Data are represented as mean ± SEM (error bars). (C) Dose-response experiment assessing the impact of bromodomain ligand-based (C646 and I-CBP112), and peptidomimetic (CWP232228) inhibition of CBP on t-hESC growth (C646, I-CPB112: n = 4; CWP232228: n = 3). (D) Early endoderm differentiation assay performed in t-hESCs in the presence of CWP232228 (0.1 μM, n = 6), I-CBP112 (0.25 μM, n = 3), or C646 (0.25 μM, n = 3) versus control DMSO (n = 6) and basal culture media (n = 3). Bar graph represents relative counts of FOXA2-positive (early endoderm marker)/OCT4-negative cells in DMSO, CWP232228, I-CBP112, and C646-treated t-hESCs versus basal culture media (one-way ANOVA, ∗∗∗: p < 0.0001). Data are represented as mean ± SEM (error bars). Scale bar: 100 μm. (E) Pro-drug CWP232228 is converted into its active form CWP231904 via hydrolysis of the phosphate group by serum/cellular alkaline phosphatase. (F) Affinity pull-down experiments using CWP231904-conjugated magnetic beads performed on whole hESC lysates. Physical interaction between CBP, Sam68, beta-Catenin, ETS, MYB, GATA2, and PTMA with immobilized CWP231904 was assessed by immunoblotting. Each protein was previously shown as a member of the CBP interactome showing selective enrichment in human primary AML versus healthy blood ( <xref ref-type=Benoit et al., 2017 ). Excess of soluble compounds (CWP and ICG001, 100 μM) were used to compete with immobilized CWP231904. Whole-cell lysate was used as input, and amine-functionalized beads were used as negative control (n = 2). The heatmap presents mean background-corrected OD signal for each putative interactor tested (gray: not tested). " width="100%" height="100%">

Journal: iScience

Article Title: Pharmacological targeting of Sam68 functions in colorectal cancer stem cells

doi: 10.1016/j.isci.2021.103442

Figure Lengend Snippet: Reverse/β-turn peptidomimetic compounds are direct interactors of Sam68 (A) Chemical structure of HAT inhibitor C646 and bromodomain ligand I-CBP112, as well as β-turn peptidomimetics ICG-001 and CWP232228. (B) Western blot analysis of CBP-catalyzed H3K14ac and H3K18ac histone acetylation marks in C646 (0.25 μM), I-CBP112 (0.25 μM), and CWP232228 (0.1 μM) t-hESCs versus control DMSO. Total histone H3 and GAPDH were used as loading control. Relative OD signal quantification versus H3 intensity is presented (C646: n = 3, I-CBP112: n = 5, CWP232228: n ≥ 3, ∗: p = 0.0183, ∗∗: p = 0.0078, ∗∗∗: p ≤ 0.00033, two-tailed t test). Data are represented as mean ± SEM (error bars). (C) Dose-response experiment assessing the impact of bromodomain ligand-based (C646 and I-CBP112), and peptidomimetic (CWP232228) inhibition of CBP on t-hESC growth (C646, I-CPB112: n = 4; CWP232228: n = 3). (D) Early endoderm differentiation assay performed in t-hESCs in the presence of CWP232228 (0.1 μM, n = 6), I-CBP112 (0.25 μM, n = 3), or C646 (0.25 μM, n = 3) versus control DMSO (n = 6) and basal culture media (n = 3). Bar graph represents relative counts of FOXA2-positive (early endoderm marker)/OCT4-negative cells in DMSO, CWP232228, I-CBP112, and C646-treated t-hESCs versus basal culture media (one-way ANOVA, ∗∗∗: p < 0.0001). Data are represented as mean ± SEM (error bars). Scale bar: 100 μm. (E) Pro-drug CWP232228 is converted into its active form CWP231904 via hydrolysis of the phosphate group by serum/cellular alkaline phosphatase. (F) Affinity pull-down experiments using CWP231904-conjugated magnetic beads performed on whole hESC lysates. Physical interaction between CBP, Sam68, beta-Catenin, ETS, MYB, GATA2, and PTMA with immobilized CWP231904 was assessed by immunoblotting. Each protein was previously shown as a member of the CBP interactome showing selective enrichment in human primary AML versus healthy blood ( Benoit et al., 2017 ). Excess of soluble compounds (CWP and ICG001, 100 μM) were used to compete with immobilized CWP231904. Whole-cell lysate was used as input, and amine-functionalized beads were used as negative control (n = 2). The heatmap presents mean background-corrected OD signal for each putative interactor tested (gray: not tested).

Article Snippet: Scramble control, KHDRBS1 (Sam68) and CREBBP (CBP) targeting shRNA expression plasmids were purchased at Millipore Sigma ( ) and co-transfected with pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260) vectors in 293-FT cells using Lipofectamine 2000 (Thermo Fisher).

Techniques: Western Blot, Two Tailed Test, Inhibition, Differentiation Assay, Marker, Magnetic Beads, Negative Control

In silico screening of peptidomimetics with enhanced binding affinity for Sam68 (A) Representation of Sam68 interacting with SH3 domain in Src kinase family proteins via proline-rich motifs located in N-terminal P1-P2 and between residues 275 and 374 (P3, P4, P5). Small molecule UCS15A is known to disrupt SH3-mediated interaction of Src with Sam68 P3-5 domains ( <xref ref-type=Sharma et al., 2001 ). (B) 2D representation of UCS15A and the peptidomimetic ICG-001 in silico predicted binding pocket in Sam68 275-374 peptide (red, oxygen; blue, nitrogen). Common residues involved in both small-molecule-binding pockets are highlighted in red. Predicted hydrogen bond length is represented by dashed lines (Å). (C) Schematic representation of the in silico structure-activity relationship analysis pipeline (PyRx) used to identify β-turn peptidomimetic molecules with enhanced binding affinity for Sam68 275-374 domain. “A” and “B” represent the positions of distinct substituents added to reverse-turn mimetic cores. (D) Dose-response curves assessing selective toxicity of peptidomimetics ICG-001, CWP232228, and PRI-724 in HT29 human colorectal cancer cell line versus normal intestinal progenitor cells HIEC (n ≥ 4, 48-h treatments). (E) Compound ranking based on predicted Keq for each β-turn analog (black dots). Only molecules presenting a standard deviation below 0.1 for a minimum of three analysis runs, with an exhaustiveness (“E”) level of “8” were plotted. Dots corresponding to ICG-001, CWP231904, PRI-724-OH, and YB-0159 were highlighted in red. Random structure ranking is represented by green dots. See also . (F) Structure of YB-0158, a phosphate-stabilized prodrug of YB-0159. (G) Docked poses of CWP231904 (left) and YB-0159 (right) in human Sam68 257-374 fragment (red, oxygen; blue, nitrogen). Glycine 305 is highlighted in red, where distinct hydrogen bond (gray dashed line) was predicted between YB-0159 and Sam68. The inset in the right pose represents a higher magnification view of the predicted hydrogen bond formation between YB-0158 and Gly305. See also . " width="100%" height="100%">

Journal: iScience

Article Title: Pharmacological targeting of Sam68 functions in colorectal cancer stem cells

doi: 10.1016/j.isci.2021.103442

Figure Lengend Snippet: In silico screening of peptidomimetics with enhanced binding affinity for Sam68 (A) Representation of Sam68 interacting with SH3 domain in Src kinase family proteins via proline-rich motifs located in N-terminal P1-P2 and between residues 275 and 374 (P3, P4, P5). Small molecule UCS15A is known to disrupt SH3-mediated interaction of Src with Sam68 P3-5 domains ( Sharma et al., 2001 ). (B) 2D representation of UCS15A and the peptidomimetic ICG-001 in silico predicted binding pocket in Sam68 275-374 peptide (red, oxygen; blue, nitrogen). Common residues involved in both small-molecule-binding pockets are highlighted in red. Predicted hydrogen bond length is represented by dashed lines (Å). (C) Schematic representation of the in silico structure-activity relationship analysis pipeline (PyRx) used to identify β-turn peptidomimetic molecules with enhanced binding affinity for Sam68 275-374 domain. “A” and “B” represent the positions of distinct substituents added to reverse-turn mimetic cores. (D) Dose-response curves assessing selective toxicity of peptidomimetics ICG-001, CWP232228, and PRI-724 in HT29 human colorectal cancer cell line versus normal intestinal progenitor cells HIEC (n ≥ 4, 48-h treatments). (E) Compound ranking based on predicted Keq for each β-turn analog (black dots). Only molecules presenting a standard deviation below 0.1 for a minimum of three analysis runs, with an exhaustiveness (“E”) level of “8” were plotted. Dots corresponding to ICG-001, CWP231904, PRI-724-OH, and YB-0159 were highlighted in red. Random structure ranking is represented by green dots. See also . (F) Structure of YB-0158, a phosphate-stabilized prodrug of YB-0159. (G) Docked poses of CWP231904 (left) and YB-0159 (right) in human Sam68 257-374 fragment (red, oxygen; blue, nitrogen). Glycine 305 is highlighted in red, where distinct hydrogen bond (gray dashed line) was predicted between YB-0159 and Sam68. The inset in the right pose represents a higher magnification view of the predicted hydrogen bond formation between YB-0158 and Gly305. See also .

Article Snippet: Scramble control, KHDRBS1 (Sam68) and CREBBP (CBP) targeting shRNA expression plasmids were purchased at Millipore Sigma ( ) and co-transfected with pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260) vectors in 293-FT cells using Lipofectamine 2000 (Thermo Fisher).

Techniques: In Silico, Binding Assay, Activity Assay, Standard Deviation

YB-0158 alters Sam68 biology in human cancer cells (A) Dose-response experiment assessing growth inhibition caused by peptidomimetics analogs CWP232228 and YB-0158 in t-hESCs (n = 3, 48-h treatments). Calculated EC 50 for each small molecule is presented in the inset table. See also . (B) Dose-response experiment assessing growth inhibition caused by peptidomimetic analogs CWP232228 and YB-0158 in HT29 colorectal cancer cells (n = 2, 48-h treatments). Calculated EC 50 for each small molecule is presented in the inset table. (C) Co-immunoprecipitation (IP) assessing changes in interaction levels between Src and Sam68 in response to CWP232228 (1.5 μM) and YB-0158 (0.3 μM) in HT29 cells (48 h) (n = 3, ∗: p = 0.021, ∗∗: p = 0.0088, two-tailed t test). Data are represented as mean ± SEM (error bars). Mouse IgGs were used as negative control for pull down. (D) Immunofluorescence staining of Sam68 in DMSO, CWP232228, and YB-0158-treated t-hESCs (48 h, n = 9). Quantification of nuclear Sam68 was performed by high-content imaging and presented as relative levels versus DMSO (∗∗: p < 0.01, ∗∗∗: p < 0.0001, two-tailed t test). Data are represented as mean ± SEM (error bars). Scale bar: 100 μm. (E) Quantification of nuclear Sam68 in HT29 cells treated with increasing doses of YB-0158, in the presence (n = 4) or absence (n = 3) of a PRMT1 inhibitor (Furamidine, 10 μM). Cells were treated for 48 h and nuclear Sam68 immunostaining was quantified by high-content imaging. Data are represented as mean ± SEM (error bars). (F) Western blot analysis of Sam68 levels in normal human intestinal progenitor cells HIEC; human colorectal cancer SW480, HT29, and HCT116 lines; mouse colon adenocarcinoma MC38 cells; t-hESCs; as well as patient-derived CSC-enriched spheroids and 3D organoids from colorectal tumor samples (n ≥ 3). Relative OD signal quantification for Sam68 versus loading control (GAPDH) is presented. (G) Dose-response experiment monitoring growth of normal intestinal cells HIEC, as well as HT29, SW480, and HCT116 colorectal cancer lines treated with YB-0158 (n ≥ 3, 48 h). A significant correlation was established between calculated EC 50 and Sam68 expression (R 2 = 0.8510, p < 0.0001, simple linear regression). (H) Cell growth experiment in HCT116 cells transduced with control/empty-mGFP (pLenti Control) or KHDRBS1 -mGFP (pLenti Sam68) overexpression vectors and treated with YB-0158 (0.3 μM, 48 h) or vehicle control (DMSO). GFP-positive cell counts upon treatments are presented versus their corresponding DMSO-treated group (n = 7, ∗∗: p = 0.003, two-tailed t test). Data are represented as mean ± SEM (error bars). (I) Cell growth experiment using HCT116 cells overexpressing wild-type Sam68 ( KHDRBS1 ) (wt Sam68) or with a mutated G305 motif (G305N Sam68) and subjected to increasing doses of YB-0158 (0.08–10 μM versus DMSO control) for 48 h. Residual transduced cells (GFP reporter) were counted for each dose and presented versus DMSO control (n ≤ 5, ∗∗∗: p < 0.001, two-tailed t test). Data are represented as mean ± SEM (error bars).

Journal: iScience

Article Title: Pharmacological targeting of Sam68 functions in colorectal cancer stem cells

doi: 10.1016/j.isci.2021.103442

Figure Lengend Snippet: YB-0158 alters Sam68 biology in human cancer cells (A) Dose-response experiment assessing growth inhibition caused by peptidomimetics analogs CWP232228 and YB-0158 in t-hESCs (n = 3, 48-h treatments). Calculated EC 50 for each small molecule is presented in the inset table. See also . (B) Dose-response experiment assessing growth inhibition caused by peptidomimetic analogs CWP232228 and YB-0158 in HT29 colorectal cancer cells (n = 2, 48-h treatments). Calculated EC 50 for each small molecule is presented in the inset table. (C) Co-immunoprecipitation (IP) assessing changes in interaction levels between Src and Sam68 in response to CWP232228 (1.5 μM) and YB-0158 (0.3 μM) in HT29 cells (48 h) (n = 3, ∗: p = 0.021, ∗∗: p = 0.0088, two-tailed t test). Data are represented as mean ± SEM (error bars). Mouse IgGs were used as negative control for pull down. (D) Immunofluorescence staining of Sam68 in DMSO, CWP232228, and YB-0158-treated t-hESCs (48 h, n = 9). Quantification of nuclear Sam68 was performed by high-content imaging and presented as relative levels versus DMSO (∗∗: p < 0.01, ∗∗∗: p < 0.0001, two-tailed t test). Data are represented as mean ± SEM (error bars). Scale bar: 100 μm. (E) Quantification of nuclear Sam68 in HT29 cells treated with increasing doses of YB-0158, in the presence (n = 4) or absence (n = 3) of a PRMT1 inhibitor (Furamidine, 10 μM). Cells were treated for 48 h and nuclear Sam68 immunostaining was quantified by high-content imaging. Data are represented as mean ± SEM (error bars). (F) Western blot analysis of Sam68 levels in normal human intestinal progenitor cells HIEC; human colorectal cancer SW480, HT29, and HCT116 lines; mouse colon adenocarcinoma MC38 cells; t-hESCs; as well as patient-derived CSC-enriched spheroids and 3D organoids from colorectal tumor samples (n ≥ 3). Relative OD signal quantification for Sam68 versus loading control (GAPDH) is presented. (G) Dose-response experiment monitoring growth of normal intestinal cells HIEC, as well as HT29, SW480, and HCT116 colorectal cancer lines treated with YB-0158 (n ≥ 3, 48 h). A significant correlation was established between calculated EC 50 and Sam68 expression (R 2 = 0.8510, p < 0.0001, simple linear regression). (H) Cell growth experiment in HCT116 cells transduced with control/empty-mGFP (pLenti Control) or KHDRBS1 -mGFP (pLenti Sam68) overexpression vectors and treated with YB-0158 (0.3 μM, 48 h) or vehicle control (DMSO). GFP-positive cell counts upon treatments are presented versus their corresponding DMSO-treated group (n = 7, ∗∗: p = 0.003, two-tailed t test). Data are represented as mean ± SEM (error bars). (I) Cell growth experiment using HCT116 cells overexpressing wild-type Sam68 ( KHDRBS1 ) (wt Sam68) or with a mutated G305 motif (G305N Sam68) and subjected to increasing doses of YB-0158 (0.08–10 μM versus DMSO control) for 48 h. Residual transduced cells (GFP reporter) were counted for each dose and presented versus DMSO control (n ≤ 5, ∗∗∗: p < 0.001, two-tailed t test). Data are represented as mean ± SEM (error bars).

Article Snippet: Scramble control, KHDRBS1 (Sam68) and CREBBP (CBP) targeting shRNA expression plasmids were purchased at Millipore Sigma ( ) and co-transfected with pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260) vectors in 293-FT cells using Lipofectamine 2000 (Thermo Fisher).

Techniques: Inhibition, Immunoprecipitation, Two Tailed Test, Negative Control, Immunofluorescence, Staining, Imaging, Immunostaining, Western Blot, Derivative Assay, Expressing, Transduction, Over Expression

Journal: iScience

Article Title: Pharmacological targeting of Sam68 functions in colorectal cancer stem cells

doi: 10.1016/j.isci.2021.103442

Figure Lengend Snippet:

Article Snippet: Scramble control, KHDRBS1 (Sam68) and CREBBP (CBP) targeting shRNA expression plasmids were purchased at Millipore Sigma ( ) and co-transfected with pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260) vectors in 293-FT cells using Lipofectamine 2000 (Thermo Fisher).

Techniques: Recombinant, Derivative Assay, Immunoprecipitation, Staining, Chromatin Immunoprecipitation, DNA Purification, SYBR Green Assay, Purification, Western Blot, RNA Sequencing Assay, Sequencing, Expressing, Transformation Assay, shRNA, Software